photography documentaries
in [Digital Cameras]
|
From: sobriquet on 20 Jun 2010 20:50 On 20 jun, 22:03, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > > First of all, I must respectfully disagree with your assertion that there is > a cultural tradition of sharing information / technology for the good of > humanity. > > Quite the contrary, humans have traditionally tried to gain the upper hand > wen it comes to who can do what, or know what. Take the Church for > instance. Right from the first days of civilized society, dignitaries in > most churches tried to convince people that they had to act a specific way > and only accept approved ideas. Any other way of conducting one's self was > strictly forbidden, often punished by death. > > And, if somebody happened to get a good idea, why, it was God who had > implanted that idea, which somehow ended up being twisted around in such a > way that it didn't help the society so much as it helped the Church. > > With that in mind, it's difficult to paint corporate America, or liberal > governments as the culprits. It's more like the product of human nature... > > Take Care, > Dudley I think that right from the start when humans acquired language, it required people to share ideas to have a kind of common conceptual ground to build on. If people would develop their ideas in private and keep them to themselves, communication wouldn't be possible and neither would scientific progress, which can be said to have started back in the days of the ancient Greeks, but even long before that, people probably tried to cultivate ideas regarding their environment in a fashion where they would construct collective conceptual models of reality to interpret their perceptions in a sensible fashion. Also, you can think of the tendency of people to share a good story near the campfire or a tendency to spread the word about some significant event or insight. People tend to enjoy hearing interesting information from others and likewise they can expect others to share information with them if they share relevant information with others, so it's a basic altruistic tendency, especially since you usually don't lose anything by sharing information in the way you would if you share scarce resources like food or valuable possessions. Then when scripture was invented, there was a tendency to collect writings and make it available to people who sought to acquire knowledge (including a tendency to share information between such repositories of information by manually copying books). Now initially it was a kind of luxury for the happy few to be able to read and write and only a small percentage of the population had access to information on such an advanced level. Not because it was intentionally being kept away from the majority of the population, but simply because the majority of the population didn't have a proper education, so they couldn't access all the information in books and they probably had little spare time to engage in such activities as most of the people were involved in menial jobs that required working long hours, tending crops or cattle or in the practice of some craft like carpentry. Later when the production of books became mechanized, it was the first time people were being prevented from sharing information freely in order to ensure fair competition between publishers. If publishers didn't have exclusive rights to distribute a particular book, that would mean that anyone who got hold of any book could simply start reproducing that book for profit and that would make it more or less impossible for authors to engage in a kind of contract with a publisher, where both the publisher and the author share the benefits of their cooperation. Commercial competition has probably always motivated people to keep information to themselves that might give them an advantage over their competitors, so most businesses have a natural tendency to guard their know-how to some degree, in order to exploit their knowledge financially. So I think this is a tendency that has a long history, but it's not necessarily a human tendency, but more of a tendency that is a by-product of a competitive market economy. Now this tendency has taken on ludicrous proportions as multinational corporations have more or less unlimited power to manipulate or dictate laws in order to suit their economic interests, without any regard for the idea that information is a collectively shared resource which benefits society as a whole in the long run, when people have free access to information, like via a public library. So it all boils down to having a fair balance between the right of corporations to keep information to themselves, in order to compete with other corporations within a legal framework that allows for fair competition and the right of individual people to share and exchange information freely for the benefit of attaining a higher level of education and enjoying the wealth of human culture, knowledge and information in a way that allows us to exploit its full potential, taking the fact into account that information is an unlimited resource (in the sense that it's not scarce like other resources, such as food or energy).
From: sobriquet on 20 Jun 2010 21:17 *************************************************************************** By reading and/or replying to this usenet posting, you acknowledge that you have read, understood and accepted the terms and conditions found at: http://www.ibbu.nl/~nsprakel/eula.txt *************************************************************************** On 20 jun, 21:11, krishnananda <kris...(a)divine-life.in.invalid> wrote: > In article > <6667f3ed-8725-4e7f-b9f5-2698e3d5b...(a)d8g2000yqf.googlegroups.com>, > [.. babbling snipped ..] > http://groups.google.com/intl/en/googlegroups/terms_of_service3.html > [.. more babbling snipped ..] Nonsense. My postings, including my terms and conditions, are not in conflict with google's terms of service. Given the amount of off-topic spam we see being posted via their groups.google service, I think it's pretty evident that they don't have much control regarding what sort of information people post via their usenet interface. I encourage you to see if you can get my groups.google account blocked, because I sincerely think that my postings are not in violation of their terms of service and simply amount to freedom of expression while respecting the conventions of usenet in general and this newsgroup rec.photo.digital in particular. Also, you have replied to my posting and that means you agree with my position on intellectual property in advance, so you're contradicting yourself if you first agree with my terms and conditions and subsequently you claim to disagree with them. You should make up your mind. If you disagree with my terms and conditions, you shouldn't respond to my posting and you shouldn't even read it. If you agree with my terms and conditions, you can reply to my postings, but then we have agreed in advance about my position regarding intellectual property, so you can't attack my position on intellectual property by replying to my posting because you would only be contradicting yourself. What you can do is post in a separate thread and start a discussion on your own terms, but then you can't quote my postings if I post in your thread, as you're only allowed to do that if you agree with my terms and conditions. Now of course you can just ignore my terms and conditions and reply as you see fit anyway, but then it would be kind of silly to accuse me of violating the terms and conditions imposed by others on their creative content that I happen to be sharing via p2p networks. So it's a kind of catch 22 situation. :-) Either way, if you attack my position by replying to my postings, you more or less disqualify yourself as a hypocrite nazi cockroach, who can't seem to make up his mind regarding the rights creative people have regarding determining the terms and conditions that govern the use of and access to their creative output. Also, I'm not advocating any criminal activity as it's perfectly legal where I live to download things like documentaries, music, photos, books, etc.. for personal use via p2p networks.
From: Dudley Hanks on 20 Jun 2010 22:01 The thing is, we are not currently living in the wee hours of civilization. A lot of water has passed under our collective bridges, and society has evolved. True, we might all benefit from more sharing, but we've developed a rather extensive, codified system of determining who gets what resources for the various aspects of the creative / productive / corporate process. Those who don't like our current system are usually free to suggest alternative systems, and the procedure for approving and implementing those changes is exhaustively spelled out in the various constitutions of affected countries. Good Luck persuading everybody your idea is better... Take Care, Dudley
From: sobriquet on 20 Jun 2010 23:01 On 21 jun, 04:01, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: > The thing is, we are not currently living in the wee hours of civilization. > > A lot of water has passed under our collective bridges, and society has > evolved. > > True, we might all benefit from more sharing, but we've developed a rather > extensive, codified system of determining who gets what resources for the > various aspects of the creative / productive / corporate process. > > Those who don't like our current system are usually free to suggest > alternative systems, and the procedure for approving and implementing those > changes is exhaustively spelled out in the various constitutions of affected > countries. > > Good Luck persuading everybody your idea is better... > > Take Care, > Dudley Well, the internet was invented by scientists and it was specifically designed in order to share information in the most efficient way. So corporations are unlikely to succeed in perverting the essential nature of information technology, but they are seriously impairing our ability to exploit the full potential of information technology. The internet is simply the ultimate virtual library, where you can find virtually everything and you never need to return anything. For people who grow up with information technology it's completely natural that they are free to share information as they please, without much regard for intellectual property laws, as intellectual property laws primarily serve corporations who misguidedly believe the internet was invented in order to make it easier for them to deprive people of their cash. Also, digital information on the internet is nothing more or less than a long string of bits, like 0010111011100000011101011110001, just like a piece of DNA is simply a string composed of 4 possible nucleotides, e.g. ACAAGTGGGGTAAAAAACCCATTTACGGGATTAGTTACTGAGATCCCCC. So when you think about the idea of people or corporations being allowed to own such abstractions as private property, you should be able to figure out how that is never going to work out in practice, given the ease with which we're able to share and distribute such digital items of information and given the fact that people are allowed to employ encryption or methods to share information anonymously. The intellectual property laws are inconsistent and incoherent as there is no sensible way to distinguish between proprietary information owned by corporations and information in the public domain that is freely accessible. If it was up to corporations, they would claim that all information belongs to corporations and there would be no public domain whatsoever. If it was up to individuals like me, it would be illegal for corporations to claim any information as their exclusive intellectual property. What's needed is a middle way and that's only possible with a neutral and transparent government that guarantees human rights instead of perpetually violating them. The current financial crisis is kind of illustrative of the kind of problems you run into when the government is more or less owned by corporations. Hopefully in the end human rights will prevail and impose sensible limits on the activities of corporations, where corporate interests are conflicting with the interests of individuals or society in general. A lot of the conflict regarding intellectual property is about controlling the flow of information and corporations who provide services that have become completely redundant with the advent of information technology. The whole distribution chain from where they reproduce books or cds all the way until the books or cds have been distributed to a retail store, has become more or less superfluous as the internet allows information to reproduce, distribute and promote itself. The only catch is that it's virtually impossible to impose controls on the whole distribution process and that's why corporations who were used to being in control of the distribution process find it very hard to accept that they have more or less become redundant as middlemen between the creative people who produce content and allow themselves to be prostituted by the intellectual property mafia and the consumers who enjoy their creative output. Anyone with a talent can simply distribute their stuff online and that way they have a direct connection with their fans and supporters on a global scale and that is naturally a preferable way to conduct their business. The apparent downside is that once they release their content, they can't really impose controls on what people are allowed to do with their creations, but it has basically always been that way for physical products, so it would be a good thing if this once again holds for immaterial products like information. Imagine you buy a loaf of bread and you have to accept a 30 page end- user-license-agreement where the baker specifies what sort of things your allowed to put on the bread and other silly restrictions. People would simply ignore it as the natural state of affairs is that once you buy a product, you're free to do with it as you please. You could buy a piece of artwork and burn it, eat it, hang it on your wall or whatever. It's ludicrous to suppose that the artist can impose arbitrary restrictions on how you're allowed to use it, like telling people they are not allowed to hang the artwork in plain sight in front of their window. So all these perversions and ludicrous distortions of creative rights are simply the result of corporations ruthlessly exploiting the mechanized and centralized reproduction and distribution of information, starting with the printing press and it will be a relief if we finally get rid of this anomalous state of affairs that is completely unnatural compared to the usual way products find their way to their respective consumers and reasonable guidelines a producer can advise regarding the use of their products (rather than silly constraints imposed by producers on the use of their products).
From: Dudley Hanks on 20 Jun 2010 23:25
"sobriquet" <dohduhdah(a)yahoo.com> wrote in message news:a4ff3ca1-1cef-4348-8ade-686f85058996(a)a30g2000yqn.googlegroups.com... > On 21 jun, 04:01, "Dudley Hanks" <dha...(a)blind-apertures.ca> wrote: >> The thing is, we are not currently living in the wee hours of >> civilization. >> >> A lot of water has passed under our collective bridges, and society has >> evolved. >> >> True, we might all benefit from more sharing, but we've developed a >> rather >> extensive, codified system of determining who gets what resources for the >> various aspects of the creative / productive / corporate process. >> >> Those who don't like our current system are usually free to suggest >> alternative systems, and the procedure for approving and implementing >> those >> changes is exhaustively spelled out in the various constitutions of >> affected >> countries. >> >> Good Luck persuading everybody your idea is better... >> >> Take Care, >> Dudley > > Well, the internet was invented by scientists and it was specifically > designed in order to share information in the most efficient way. > So corporations are unlikely to succeed in perverting the essential > nature of information technology, but they are seriously impairing our > ability to exploit the full potential of information technology. > > The internet is simply the ultimate virtual library, where you can > find virtually everything and you never need to return anything. > For people who grow up with information technology it's completely > natural that they are free to share information as they please, > without much regard for intellectual property laws, as intellectual > property laws primarily serve corporations who misguidedly believe the > internet was invented in order to make it easier for them to deprive > people of their cash. > Also, digital information on the internet is nothing more or less than > a long string of bits, like 0010111011100000011101011110001, just like > a piece of DNA is simply a string composed of 4 possible nucleotides, > e.g. ACAAGTGGGGTAAAAAACCCATTTACGGGATTAGTTACTGAGATCCCCC. > So when you think about the idea of people or corporations being > allowed to own such abstractions as private property, you should be > able to figure out how that is never going to work out in practice, > given the ease with which we're able to share and distribute such > digital items of information and given the fact that people are > allowed to employ encryption or methods to share information > anonymously. > > The intellectual property laws are inconsistent and incoherent as > there is no sensible way to distinguish between proprietary > information owned by corporations and information in the public > domain that is freely accessible. > If it was up to corporations, they would claim that all information > belongs to corporations and there would be no public domain > whatsoever. If it was up to individuals like me, it would be illegal > for corporations to claim any information as their exclusive > intellectual property. What's needed is a middle way and that's only > possible with a neutral and transparent government that guarantees > human rights instead of perpetually violating them. > The current financial crisis is kind of illustrative of the kind of > problems you run into when the government is more or less owned by > corporations. > > Hopefully in the end human rights will prevail and impose sensible > limits on the activities of corporations, where corporate interests > are conflicting with the interests of individuals or society in > general. > > A lot of the conflict regarding intellectual property is about > controlling the flow of information and corporations who provide > services that have become completely redundant with the advent of > information technology. The whole distribution chain from where they > reproduce books or cds all the way until the books or cds have been > distributed to a retail store, has become more or less superfluous as > the internet allows information to reproduce, distribute and promote > itself. The only catch is that it's virtually impossible to impose > controls on the whole distribution process and that's why corporations > who were used to being in control of the distribution process find it > very hard to accept that they have more or less become redundant as > middlemen between the creative people who produce content and allow > themselves to be prostituted by the intellectual property mafia and > the consumers who enjoy their creative output. > > Anyone with a talent can simply distribute their stuff online and that > way they have a direct connection with their fans and supporters on a > global scale and that is naturally a preferable way to conduct their > business. The apparent downside is that once they release their > content, they can't really impose controls on what people are allowed > to do with their creations, but it has basically always been that way > for physical products, so it would be a good thing if this once again > holds for immaterial products like information. > > Imagine you buy a loaf of bread and you have to accept a 30 page end- > user-license-agreement where the baker specifies what sort of things > your allowed to put on the bread and other silly restrictions. People > would simply ignore it as the natural state of affairs is that once > you buy a product, you're free to do with it as you please. > You could buy a piece of artwork and burn it, eat it, hang it on your > wall or whatever. It's ludicrous to suppose that the artist can impose > arbitrary restrictions on how you're allowed to use it, like telling > people they are not allowed to hang the artwork in plain sight in > front of their window. > > So all these perversions and ludicrous distortions of creative rights > are simply the result of corporations ruthlessly exploiting the > mechanized and centralized reproduction and distribution of > information, starting with the printing press and it will be a relief > if we finally get rid of this anomalous state of affairs that is > completely unnatural compared to the usual way products find their way > to their respective consumers and reasonable guidelines a producer can > advise regarding the use of their products (rather than silly > constraints imposed by producers on the use of their products). I must most respectfully disagree that corporations / businesses are impairing our ability to desseminate information. While the internet has its origins in the academic world, the research was driven / funded by corporate donations which were allocated to business faculties as well as more traditional scientific departments. Furthering the aims of businesses through networking was as much on the minds of those scientists as linking telescopes and physics departments. To get a look at how closely university faculty members and business growth can be related, just look into the history of Netscape. Take Care, Dudley |